Aberration Dmel\Df(2R)P803-Δ15

General Information
Symbol	Dmel\Df(2R)P803-Δ15	Species	D. melanogaster
Name		FlyBase ID	FBab0029691
Feature type	chromosomal_deletion
Also Known As	Df(2R)P803-Delta15

Computed Breakpoints include
Deleted segment	53E--53F11
Sequence coordinates
Member of large scale dataset(s)
Recent Updates
Description	What does this section display? This section contains items that were added to this record for each release. It currently only tracks new links between this FlyBase report and other FlyBase data classes (e.g. genes, references, stocks) or controlled vocabulary terms (e.g. GO, anatomy terms). What does this section not display? This section does not currently display links that were removed or gene model changes.
Update Feed	Click the icon below to subscribe to this FlyBase record and receive updates automatically through your feed reader.
FB2013_03
FB2013_02
All updates	Click here to see a list of all updates to this record from FB2010_08 and on.
Nature of the Aberration
Cytological Order
Progenitor	P{lacW}GstS1^k08805 (Tomkiel, 2001.12.6)
Mutagen	Delta2-3 (Tomkiel, 2001.12.6)
Class of aberration (relative to progenitor)	chromosomal_deletion (Tomkiel, 2001.12.6)
Breakpoints	[];[] (Tomkiel, 2001.12.6)
Causes alleles	Ark^P803-Δ15 (Tomkiel, 2001.12.6)
Carries alleles	cn¹ (Tomkiel, 2001.12.6)
Transposon Insertions
Formalized genetic data
Genetic mapping information
Comments
Comments on Cytology

Sequence Crossreferences
DDBJ / EMBL / GenBank	DNA sequence Protein sequence Name
Gene Deletion & Duplication Data
Genes Deleted / Disrupted
Complementation Data
Completely deleted / disrupted	Ark (Mills et al., 2006) GstS1 (Tomkiel, 2001.12.6) RhoGEF2 (Bayer et al., 2003) tef (Tomkiel, 2001.12.6, Arya et al., 2006)
Molecular Data
Genes NOT Deleted / Disrupted
Complementation Data
Molecular Data
Genes Duplicated
Complementation Data
Molecular Data
Genes NOT Duplicated
Complementation Data
Molecular Data
Related Comments

Phenotypic Data
In combination with other aberrations	Inferred to overlap with: Df(2R)ED1. (Ryder and Roote, 2004.11.10) Lethal in combination with Df(2R)ED1. (Ryder et al., 2004) Lethal in combination with Df(2R)ED1. Lethal in combination with In(2LR)DTD99. (Roote, 2002.2.6)
NOT in combination with other aberrations
Stocks ( 2 )
Bloomington	6404 y¹; Df(2R)P803-Δ15, cn¹/SM1; sv^spa-pol
Kyoto	108769 y¹; Df(2R)P803-Δ15, cn¹/SM1; sv^spa-pol
Notes on Origin
Discoverer

Balancer / Genotype Variants of the Aberration

Separable Components

Other Comments
	Deletion extending from the 3' end of the P{lacW}GstS1^k08805 insertion to a site within the coding sequence of the Ark gene. The P{lacW} element sequence is adjacent to the sequence GGTTTAGCAATTATTACTTTATTT within the Ark gene. The 5' and 3' ends of the P{lacW} element are present and non-rearranged (determined by DNA sequencing) and the w^+mC marker within the element is still present (as judged by phenotype). (Tomkiel, 2001.12.6)
Synonyms & Secondary IDs ( 5 )
Reported As
Symbol Synonym	Df(2R)P803-D1 (Minakhina and Steward, 2006) Df(2R)P803-D15 (Ryder and Roote, 2004.11.10) Df(2R)P803-Delta15 (Mills et al., 2006, Bayer et al., 2003) Df(2R)P803-Δ15 P803Δ15 (Arya et al., 2006)
Name Synonym
Secondary FlyBase IDs

References ( 11 )
Research paper	Arya et al., 2006, Genetics 174(1): 125--134 Molecular characterization of teflon, a gene required for meiotic autosome segregation in male Drosophila melanogaster. [FBrf0194210] Mills et al., 2006, J. Cell Biol. 172(6): 809--815 The Drosophila melanogaster Apaf-1 homologue ARK is required for most, but not all, programmed cell death. [FBrf0190939] Minakhina and Steward, 2006, Genetics 174(1): 253--263 Melanotic mutants in Drosophila: pathways and phenotypes. [FBrf0194475] Hirai et al., 2004, Genetics 166(4): 1795--1806 Isolation and cytogenetic characterization of male meiotic mutants of Drosophila melanogaster. [FBrf0174695] Ryder et al., 2004, Genetics 167(2): 797--813 The DrosDel collection: a set of P-element insertions for generating custom chromosomal aberrations in Drosophila melanogaster. [FBrf0179424] Bayer et al., 2003, Genetics 165(3): 1417--1432 Genetic interactions between the RhoA and Stubble-stubbloid loci suggest a role for a type II transmembrane serine protease in intracellular signaling during Drosophila imaginal disc morphogenesis. [FBrf0167640] Presgraves, 2003, Genetics 163(3): 955--972 A fine-scale genetic analysis of hybrid incompatibilities in Drosophila. [FBrf0158988]
Personal communication to FlyBase	Ryder and Roote, 2004.11.10, DrosDel deletions confirmed by PCR and genetic tests. DrosDel deletions confirmed by PCR and genetic tests. [FBrf0179888] Roote, 2002.2.6, Df kit. Df kit. [FBrf0145636] Tomkiel, 2001.12.6, Df(2R)P803-delta15. Df(2R)P803-delta15. [FBrf0141808]
FlyBase analysis	FlyBase, 2007, En masse symbol-based assigment of Aberration Class with respect to wild type. En masse symbol-based assigment of Aberration Class with respect to wild type. [FBrf0191808]