Aberration Dmel\Df(2R)P803-Δ15
| General Information | |||
|---|---|---|---|
| Symbol | Dmel\Df(2R)P803-Δ15 | Species | D. melanogaster |
| Name | FlyBase ID | FBab0029691 | |
| Feature type | chromosomal_deletion | ||
| Also Known As | Df(2R)P803-Delta15 | ||
| Computed Breakpoints include | |||
| Deleted segment | 53E--53F11 | ||
| Sequence coordinates | |||
| Member of large scale dataset(s) | |||
Recent Updates
|
|||
| Description |
What does this section display?
This section contains items that were added to this record for each release.
It currently only tracks new links between this FlyBase report and other
FlyBase data classes (e.g. genes, references, stocks) or controlled
vocabulary terms (e.g. GO, anatomy terms).
What does this section not display?
This section does not currently display links that were removed or gene model changes.
|
||
| Update Feed |
Click the icon below to subscribe to this FlyBase record and receive updates automatically through your
feed reader.
|
||
| FB2013_03 | |||
| FB2013_02 | |||
| All updates | Click here to see a list of all updates to this record from FB2010_08 and on. | ||
Nature of the Aberration
| |||
| Cytological Order | |||
| Progenitor | |||
| Mutagen | |||
| Class of aberration (relative to progenitor) | |||
| Breakpoints | [];[] | ||
| Causes alleles | |||
| Carries alleles | |||
| Transposon Insertions | |||
| Formalized genetic data | |||
| Genetic mapping information | |||
| Comments | |||
Comments on Cytology
| |||
Sequence Crossreferences
| |||
| DDBJ
/
EMBL / GenBank | DNA sequence Protein sequence Name | ||
Gene Deletion & Duplication Data
| |||
Genes Deleted / Disrupted
| |||
| Complementation Data | |||
| Completely deleted / disrupted | |||
| Molecular Data | |||
Genes NOT Deleted / Disrupted
| |||
| Complementation Data | |||
| Molecular Data | |||
Genes Duplicated
| |||
| Complementation Data | |||
| Molecular Data | |||
Genes NOT Duplicated
| |||
| Complementation Data | |||
| Molecular Data | |||
Related Comments
| |||
Phenotypic Data
| |||
| In combination with other aberrations | Inferred to overlap with: Df(2R)ED1. Lethal in combination with Df(2R)ED1. Lethal in combination with Df(2R)ED1. Lethal in combination with In(2LR)DTD99. | ||
| NOT in combination with other aberrations | |||
Stocks
( 2 ) | |||
| Bloomington | |||
| Kyoto | |||
Notes on Origin
| |||
| Discoverer | |||
Balancer / Genotype Variants of the Aberration
| |||
Separable Components
| |||
Other Comments
| |||
Deletion extending from the 3' end of the P{lacW}GstS1k08805 insertion to a site within the coding sequence of the Ark gene. The P{lacW} element sequence is adjacent to the sequence GGTTTAGCAATTATTACTTTATTT within the Ark gene. The 5' and 3' ends of the P{lacW} element are present and non-rearranged (determined by DNA sequencing) and the w+mC marker within the element is still present (as judged by phenotype). | |||
Synonyms & Secondary IDs
( 5 ) | |||
| Reported As | |||
| Symbol Synonym | Df(2R)P803-D1 Df(2R)P803-D15 Df(2R)P803-Delta15 Df(2R)P803-Δ15 P803Δ15 | ||
| Name Synonym | |||
| Secondary FlyBase IDs | |||
References
( 11 ) | |||
| Research paper |
| ||
| Personal communication to FlyBase |
| ||
| FlyBase analysis |
| ||
Recent Updates