Open Close
General Information
Symbol
Df(3L)3583-321
Species
D. melanogaster
Name
FlyBase ID
FBab0047444
Feature type
Computed Breakpoints include
Sequence coordinates
3L:9,373,644..9,373,644 (Df(3L)3583-321:bk1)
3L:9,383,985..9,383,985 (Df(3L)3583-321:bk2)
Member of large scale dataset(s)
Nature of Aberration
Cytological Order
Class of aberration (relative to wild type)
Class of aberration (relative to progenitor)
Breakpoints
Causes alleles
Carries alleles
Transposon Insertions
Formalized genetic data
Genetic mapping information
Comments

Activation of the P{EP} element in Hsp27EP3583 has resulted in a 10,342bp deletion removing 5 genes (Hsp23, Hsp67Ba, Hsp26, CG4461 and Hsp22). The P{EP} starting element has been retained. The deletion contains a 26bp imperfect duplication of the 31bp P-terminal repeats at the 5'-P end (GGACCACCTTATGTTATTTCATCATG).

Reported as 3L:9 ,366,744 in R5 coordinates.

Reported as 3L:9 ,377,085 in R5 coordinates.

Comments on Cytology
Sequence Crossreferences
DNA sequence
Protein sequence
Gene Deletion and Duplication Data
Genes Deleted / Disrupted
Complementation Data
Completely deleted / disrupted
Partially deleted / disrupted
Molecular Data
Partially deleted
Genes NOT Deleted / Disrupted
Complementation Data
 
Molecular Data
 
Genes Duplicated
Complementation Data
Completely duplicated
Partially duplicated
Molecular Data
Completely duplicated
Partially duplicated
Genes NOT Duplicated
Complementation Data
 
Molecular Data
 
Phenotypic Data
In combination with other aberrations
NOT in combination with other aberrations
Stocks (0)
Notes on Origin
Discoverer
 
Balancer / Genotype Variants of the Aberration
 
Separable Components
 
Other Comments
 
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
Df(3L)3583-321
Name Synonyms
Secondary FlyBase IDs
    References (1)