A TI{KozakGAL4} DNA cassette has been inserted into rb, replacing the coding sequence (coordinates of deleted sequence are X:4536574..4540602 , release 6 genome). This results in a simultaneous knock-out of rb plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of rb (predicted to gene trap all annotated transcripts of the gene). The deletion also removes part of lncRNA:CR32773. The upstream end of the deletion associated with the insertion is 306 bp from the annotated TSS of the CHOp24 gene on the opposite strand and may affect its expression. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: TTTAGCTTTCTGTTTCCTAATGG and GAGTGGAATCCCCTGGAGCAGGG.