A TI{CRIMIC.TG4.2} DNA cassette has been inserted into CG34140, in a coding intron, and is predicted to gene trap all annotated transcripts of the gene. In addition, the coding exons of CG34140 downstream of the inserted gene trap cassette have been deleted. The deletion affects a dicistronic transcript that encodes CG34140 and one of the isoforms of Mkp and thus Mkp may also be affected. The TI{CRIMIC.TG4.2} cassette was inserted via the CRISPR/Cas-9 hybrid technique, using two gRNAs that target CG34140 : one targeted to a coding intron (AAGACTTACCACCCCTACAGTGG) and the other to a non-coding exon in the 3' UTR (GGTATTAAATGTCCGTTTCTCGG).