A TI{KozakGAL4} DNA cassette has been inserted into Rrp40, replacing the coding sequence (coordinates of deleted sequence are 2L:1728766..1729529 , release 6 genome). This results in a simultaneous knock-out of Rrp40 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Rrp40 (predicted to gene trap all annotated transcripts of the gene). The insertion also removes part of Eno. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: CGTGTGTCTTTCAAAACATATGG and GTAAACTAAGAACTAATCCTAGG.