A TI{KozakGAL4} DNA cassette has been inserted into CG43345, replacing the coding sequence (coordinates of deleted sequence are 2L:21166654..21168239 , release 6 genome). This results in a simultaneous knock-out of CG43345 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of CG43345 (predicted to gene trap all annotated transcripts of the gene). The deletion removes part of a dicistronic transcript that encodes CG43346 as well as CG43345 and thus expression of CG43346 may also be affected. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: GGATCAGGACTAATGCTGACTGG and GTGGCGGTGTTGCAAAATGCCGG.