A TI{KozakGAL4} DNA cassette has been inserted into CkIIβ2, replacing the coding sequence (coordinates of deleted sequence are 2R:20289574..20290500 , release 6 genome). This results in a simultaneous knock-out of CkIIβ2 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of CkIIβ2 (predicted to gene trap all annotated transcripts of the gene). The deletion is also within an intron of Cpr56F. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: GGGACGGAGTGTTCAATCAAGGG and GTGGGCACTGTTCGCCCGGCTGG.