A TI{CRIMIC.TG4.1} DNA cassette has been inserted into Ip6k, in a coding intron, and is predicted to gene trap all annotated transcripts of the gene. The insertion is also within asRNA:CR43786, not in a coding intron, and is not predicted to gene trap this gene. All of the coding sequences of Ip6k downstream of the inserted gene trap cassette have been deleted, and almost the entire transcribed region of asRNA:CR43786 has been deleted. The TI{CRIMIC.TG4.1} cassette was inserted via the CRISPR/Cas-9 hybrid technique, using two gRNAs that target Ip6k : one targeted to a coding intron (GAAAGCATACTCTTCTCATCTGG) and the other to a non-coding exon in the 3' UTR (GAATATATATATGGGGCAACTGG).