FB2025_01 , released February 20, 2025
Aberration: Dmel\Df(3R)CRIMIC-CR70994
Open Close
General Information
Symbol
Df(3R)CRIMIC-CR70994
Species
D. melanogaster
Name
FlyBase ID
FBab0049407
Feature type
Computed Breakpoints include
Sequence coordinates
3R:12,001,478..12,001,478 (Df(3R)CRIMIC-CR70994:bk1)
3R:12,003,359..12,003,359 (Df(3R)CRIMIC-CR70994:bk2)
Member of large scale dataset(s)
Nature of Aberration
Cytological Order
Progenitor
Class of aberration (relative to wild type)
Class of aberration (relative to progenitor)
Breakpoints
Carries alleles
Formalized genetic data
Genetic mapping information
Comments

A TI{CRIMIC.TG4.2} DNA cassette has been inserted into Ect3, in a coding intron, and is predicted to gene trap all annotated transcripts of the gene. In addition, the coding exons of Ect3 downstream of the inserted gene trap cassette have been deleted. The insertion is also within an intron in the 5'UTR of Tk, and the deletion removes Tk intron sequences. The TI{CRIMIC.TG4.2} cassette was inserted via the CRISPR/Cas-9 hybrid technique, using two gRNAs that target Ect3 : one targeted to a coding intron (TCCACATAGCTTGTAGTTAATGG) and the other to a non-coding exon in the 3' UTR (CGCGAGGACCGTTTAGTCGTCGG).

Comments on Cytology
Sequence Crossreferences
DNA sequence
Protein sequence
Gene Deletion and Duplication Data
Genes Deleted / Disrupted
Complementation Data
Completely deleted / disrupted
Partially deleted / disrupted
Molecular Data
Completely deleted
Genes NOT Deleted / Disrupted
Complementation Data
 
Molecular Data
 
Genes Duplicated
Complementation Data
Completely duplicated
Partially duplicated
Molecular Data
Completely duplicated
Partially duplicated
Genes NOT Duplicated
Complementation Data
 
Molecular Data
 
Affected Genes Inferred by Location (2)
Phenotypic Data
In combination with other aberrations
NOT in combination with other aberrations
Stocks (1)
Notes on Origin
Discoverer
 
Balancer / Genotype Variants of the Aberration
 
Separable Components
 
Other Comments
 
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
Df(3R)CRIMIC-CR70994
Name Synonyms
Secondary FlyBase IDs
    References (1)