A TI{CRIMIC.TG4.2} DNA cassette has been inserted into Ect3, in a coding intron, and is predicted to gene trap all annotated transcripts of the gene. In addition, the coding exons of Ect3 downstream of the inserted gene trap cassette have been deleted. The insertion is also within an intron in the 5'UTR of Tk, and the deletion removes Tk intron sequences. The TI{CRIMIC.TG4.2} cassette was inserted via the CRISPR/Cas-9 hybrid technique, using two gRNAs that target Ect3 : one targeted to a coding intron (TCCACATAGCTTGTAGTTAATGG) and the other to a non-coding exon in the 3' UTR (CGCGAGGACCGTTTAGTCGTCGG).