A TI{KozakGAL4} DNA cassette has been inserted into Arr2, replacing the coding sequence (coordinates of deleted sequence are 3L:8647405..8648828 , release 6 genome). This results in a simultaneous knock-out of Arr2 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Arr2 (predicted to gene trap all annotated transcripts of the gene). The deletion is also within an intron in the 5' UTR of the Pex7-RA transcript. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: AGAAATCCACTAATCCACAATGG and TTTGTTGCAGCAGTCTCTCGTGG.