A TI{KozakGAL4} DNA cassette has been inserted into Irp-1A, replacing the coding sequence (coordinates of deleted sequence are 3R:22721397..22724575 , release 6 genome). This results in a simultaneous knock-out of Irp-1A plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Irp-1A (predicted to gene trap all annotated transcripts of the gene). One of the endpoints of the deletion is within the transcribed sequences of asRNA:CR45648. Most of the transcribed sequences of asRNA:CR45648 are deleted. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: GATATAGAGATGAGCGCGTGAGG and AAGTCGCCTAGAAATGCATATGG.