A TI{KozakGAL4} DNA cassette has been inserted into Tim9b, replacing the coding sequence (coordinates of deleted sequence are X:19617947..19618498 , release 6 genome). This results in a simultaneous knock-out of Tim9b plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Tim9b (predicted to gene trap all annotated transcripts of the gene). The deletion also affects exons that encode the 5'UTR of all annotated isoforms of Pstk. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: TCCGCTCGTCACGAACGTGACGG and ATCTGTCCATGTAGCAGCAGTGG.