A TI{KozakGAL4} DNA cassette has been inserted into Tspo, replacing the coding sequence (coordinates of deleted sequence are 2L:559678..560388 , release 6 genome). This results in a simultaneous knock-out of Tspo plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Tspo (predicted to gene trap all annotated transcripts of the gene). The deletion also removes most of the 5' UTR of the rempA-RC transcript and extends 73 bp into the region flanking its annotated 5' end. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: CAGAGTTCGCACTGCAAATGAGG and GCTTTCCGACCTATCGAACCAGG.