A TI{KozakGAL4} DNA cassette has been inserted into Ufsp1, replacing the coding sequence (coordinates of deleted sequence are 2R:6974062..6974909 , release 6 genome). This results in a simultaneous knock-out of Ufsp1 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Ufsp1 (predicted to gene trap all annotated transcripts of the gene). The deletion also removes most of an intron in the 5' UTR of the Cyp6u1-RA and Cyp6u1-RC transcripts. The 3' end of the deletion is 33 bp upstream of the 5' end of the Cyp6u1-RB transcript and may affect its expression. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: GGAGCAGGTGAATCAGGCCTAGG and AATAGTAATCAAGAGCTGAGCGG.