A TI{KozakGAL4} DNA cassette has been inserted into Rpn12R, replacing the coding sequence (coordinates of deleted sequence are 3L:15041153..15042505 , release 6 genome). This results in a simultaneous knock-out of Rpn12R plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Rpn12R (predicted to gene trap all annotated transcripts of the gene). The deletion also removes part of a coding intron of Sytβ. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: TAAATCATTGCTTTCTATTATGG and AGAACATTGAATATATCCCCAGG.