A TI{KozakGAL4} DNA cassette has been inserted into CSN6, replacing the coding sequence (coordinates of deleted sequence are 3R:22580864..22582030 , release 6 genome). This results in a simultaneous knock-out of CSN6 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of CSN6 (predicted to gene trap all annotated transcripts of the gene). The deletion also extends 2 bp into the 3' UTR of the Dph5 gene on the opposite strand. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: CTTTATTTACACGTAGTTTGCGG and AATACACATAATCGTACGATGGG.