A TI{KozakGAL4} DNA cassette has been inserted into Nepl21, replacing the coding sequence (coordinates of deleted sequence are 3R:28883692..28885864 , release 6 genome). This results in a simultaneous knock-out of Nepl21 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Nepl21 (predicted to gene trap all annotated transcripts of the gene). The insertion is also within CG33203 (as Nepl21 is nested within an intron of Df(3R)CRIMIC-CR71299). The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: GAGGCACGACAGTCGATCATGGG and TTGACCATGTTTACCCTATTTGG.