A TI{KozakGAL4} DNA cassette has been inserted into cDIP, replacing the coding sequence (coordinates of deleted sequence are 3R:21159367..21161071 , release 6 genome). This results in a simultaneous knock-out of cDIP plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of cDIP (predicted to gene trap all annotated transcripts of the gene). The insertion is also within SNF4Aγ (as cDIP is nested within an intron of SNF4Aγ). The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: TTCAGGTCGAACGTGAATCGTGG and TGTAGTGATCACATAAAAAATGG.