A TI{CRIMIC.TG4.0} DNA cassette has been inserted into egg, in a coding intron, and is predicted to gene trap all annotated transcripts of the gene. In addition, the coding exons of egg downstream of the inserted gene trap cassette have been deleted. The deletion also removes part of asRNA:CR44067, including the annotated transcription start site and 5' exon. The TI{CRIMIC.TG4.0} cassette was inserted via the CRISPR/Cas-9 hybrid technique, using two gRNAs that target egg : one targeted to a coding intron (GGAACTTCATGCTGAGTAAATGG) and the other to a non-coding exon in the 3' UTR (TAATGAGTATATTTCCTGTATGG).