A TI{CRIMIC.TG4.1} DNA cassette has been inserted into Pfrx, in a coding intron, and is predicted to gene trap a subset of the annotated transcripts of the gene. In addition, the coding exons of Pfrx downstream of the inserted gene trap cassette have been deleted. The deletion also removes part of CG14200 (Pfrx is nested within an intron of CG14200). The TI{CRIMIC.TG4.1} cassette was inserted via the CRISPR/Cas-9 hybrid technique, using two gRNAs that target Pfrx : one targeted to a coding intron (CACCGTGACCGTCTTAATCGCGG) and the other to a non-coding exon in the 3' UTR (CAGCCGTGCTTAGATTGTCTTGG).