A TI{KozakGAL4} DNA cassette has been inserted into Gs1, replacing the coding sequence (coordinates of deleted sequence are 2L:132201..133688 , release 6 genome). This results in a simultaneous knock-out of Gs1 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Gs1 (predicted to gene trap all annotated transcripts of the gene). The deletion also removes part of ND-15 (Gs1 is nested within an intron of ND-15). The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: TTGGTTAAACAGTCGCTGGTTGG and CTCAACGAGTAGGCTGTGAGCGG.