A TI{KozakGAL4} DNA cassette has been inserted into CG18128, replacing the coding sequence (coordinates of deleted sequence are 2R:23718789..23719870 , release 6 genome). This results in a simultaneous knock-out of CG18128 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of CG18128 (predicted to gene trap all annotated transcripts of the gene). The deletion also removes part of CG46429 and Sesn (CG18128 is nested within an intron of the dicistronic transcript that encodes CG46429 and Sesn). The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: GGTGAAGTTTCGCACTCATTTGG and GGAATCCGAATAGAAGAAGTCGG.