A TI{KozakGAL4} DNA cassette has been inserted into Rpn13R, replacing the coding sequence (coordinates of deleted sequence are X:5131955..5132940 , release 6 genome). This results in a simultaneous knock-out of Rpn13R plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Rpn13R (predicted to gene trap all annotated transcripts of the gene). The insertion and associated deletion is also within an intron in the 5' UTR of the CG15465 and rg genes. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: GAAAATTTCCAGTATCCACATGG and ATATATTTATAAGAACCTCACGG.