Insertion of 38 base pairs after codon 124 that introduces two stop codons, one within and the other just downstream of the insertion. Codon 124 falls well before the first transmembrane domain.
CATGATGAAATAACATGTTATTTCATCATGAGCTGAAC
Insertion of 38 base pairs after codon 124 that introduces two stop codons, one within and the other just downstream of the insertion.
The size of smoD16 homozygous follicle cell clones in the germarium is significantly smaller than control clones.
Follicle stem cell clones homozygous for smoD16 are present at a much lower frequency than control clones at 7 days (25% vs 73%) and 14 days (6% vs 57%) after clone induction.
Homozygous cells in the morphogenetic furrow (in clones that encompass the morphogenetic furrow) show a significant impairment in apical constriction.
Unlike neutral somatic clones, smoD16 homozygous somatic clones are rapidly lost from the somatic stem cell population of the germarium so that, by 3 weeks after clone induction, none remain.
When smoD16 clones are made in the posterior margin of the eye disc, clones lack photoreceptor differentiation.
Somatic clones of smoD16 in the ocellar triangle (ocellar cuticle) lead to reduced or absent ocelli. The medial ocellus is occasionally split in two.
Cells in clones in the eye disc fail to enter S phase in the second mitotic wave.
Embryos derived from germline clone females exhibit loss of naked cuticle and polarity of the embryo is lost.
smo[+]/smoD16 is a suppressor of visible phenotype of Scer\GAL4Bx-MS1096, fuUAS.Tag:Palm(hGAP43),CFP
smoD16 has eye disc | somatic clone phenotype, non-enhanceable by dppUAS.cSa/Scer\GAL4ey.PB
smoD16 has eye disc morphogenetic furrow | somatic clone phenotype, non-enhanceable by dppUAS.cSa/Scer\GAL4ey.PB
smoD16 has photoreceptor neuron | somatic clone phenotype, non-enhanceable by Scer\GAL4ey.PB/soUAS.cPa/eyaUAS.cPa
smoD16 has photoreceptor neuron | somatic clone phenotype, non-enhanceable by dppUAS.cSa/Scer\GAL4ey.PB
smoD16 has eye disc | somatic clone phenotype, non-enhanceable by Scer\GAL4ey.PB/eyaUAS.cPa
smoD16 has eye disc morphogenetic furrow | somatic clone phenotype, non-enhanceable by Scer\GAL4ey.PB/eyaUAS.cPa
smoD16 has photoreceptor neuron | somatic clone phenotype, non-enhanceable by Scer\GAL4ey.PB/eyaUAS.cPa
smoD16 has eye disc | somatic clone phenotype, non-enhanceable by dppUAS.cSa/Scer\GAL4ey.PB/soUAS.cPa
smoD16 has photoreceptor neuron | somatic clone phenotype, non-enhanceable by dppUAS.cSa/Scer\GAL4ey.PB/soUAS.cPa
smoD16 has eye disc | somatic clone phenotype, non-enhanceable by Scer\GAL4ey.PB/soUAS.cPa/eyaUAS.cPa
smoD16 has eye disc morphogenetic furrow | somatic clone phenotype, non-enhanceable by Scer\GAL4ey.PB/soUAS.cPa/eyaUAS.cPa
smoD16 has eye disc | somatic clone phenotype, suppressible by Scer\GAL4ey.PB/soUAS.cPa/eyaUAS.cPa
smoD16 has photoreceptor neuron | somatic clone phenotype, suppressible by dppUAS.cSa/Scer\GAL4ey.PB/eyaUAS.cPa
smoD16 has eye disc morphogenetic furrow | somatic clone phenotype, suppressible by dppUAS.cSa/Scer\GAL4ey.PB/eyaUAS.cPa
smoD16 has follicle stem cell | somatic clone phenotype, non-suppressible by Scer\GAL4Act5C.PI/tkvQ199D.UAS
smoD16 has eye disc | somatic clone phenotype, non-suppressible by dppUAS.cSa/Scer\GAL4ey.PB
smoD16 has eye disc morphogenetic furrow | somatic clone phenotype, non-suppressible by dppUAS.cSa/Scer\GAL4ey.PB
smoD16 has photoreceptor neuron | somatic clone phenotype, non-suppressible by Scer\GAL4ey.PB/soUAS.cPa/eyaUAS.cPa
smoD16 has photoreceptor neuron | somatic clone phenotype, non-suppressible by dppUAS.cSa/Scer\GAL4ey.PB
smoD16 has eye disc | somatic clone phenotype, non-suppressible by Scer\GAL4ey.PB/eyaUAS.cPa
smoD16 has eye disc morphogenetic furrow | somatic clone phenotype, non-suppressible by Scer\GAL4ey.PB/eyaUAS.cPa
smoD16 has photoreceptor neuron | somatic clone phenotype, non-suppressible by Scer\GAL4ey.PB/eyaUAS.cPa
smoD16 has eye disc | somatic clone phenotype, non-suppressible by dppUAS.cSa/Scer\GAL4ey.PB/soUAS.cPa
smoD16 has photoreceptor neuron | somatic clone phenotype, non-suppressible by dppUAS.cSa/Scer\GAL4ey.PB/soUAS.cPa
smoD16 has eye disc | somatic clone phenotype, non-suppressible by Scer\GAL4ey.PB/soUAS.cPa/eyaUAS.cPa
smoD16 has eye disc morphogenetic furrow | somatic clone phenotype, non-suppressible by Scer\GAL4ey.PB/soUAS.cPa/eyaUAS.cPa
smoD16/+ restores an almost wild-type wing phenotype in animals expressing fuScer\UAS.T:Hsap\Myr2,T:Avic\GFP-CFP under the control of Scer\GAL4Bx-MS1096.
The rapid loss of smoD16 homozygous somatic clone cells from the somatic stem cell population of the germarium is not significantly suppressed if the clone cells are also tkvQ199D.Scer\UAS; Scer\GAL4Act5C.PI (Scer\GAL80 method).
The addition of dppScer\UAS.cSa or eyaScer\UAS.cPa (driven by Scer\GAL4ey.PB) to animals with smoD16 clones in the eye disc has no effect on the photoreceptor differentiation phenotype seen in eye discs. The delayed progression of the morphogenetic furrow is also not affected. The addition of soScer\UAS.cPa and eyaScer\UAS.cPa (driven by Scer\GAL4ey.PB) to animals with smoD16 clones in the eye disc has no effect on the photoreceptor differentiation phenotype seen in eye discs. The delayed progression of the morphogenetic furrow is also not affected. The addition of dppScer\UAS.cSa and eyaScer\UAS.cPa (driven by Scer\GAL4ey.PB) to animals with smoD16 clones in the eye disc, fully suppresses photoreceptor differentiation phenotype seen in eye discs. The delayed progression of the morphogenetic furrow is also rescued. If soScer\UAS.cPa is also added, posterior margin clones are still rescued, although ectopic anterior furrows are induced with high frequency. The addition of soScer\UAS.cPa and dppScer\UAS.cSa (driven by Scer\GAL4ey.PB) to animals with smoD16 clones in the eye disc has no effect on the photoreceptor differentiation phenotype seen in eye discs.
Suppresses slmb induced outgrowths in mutant clones.
Likely to be a null allele.