FlyBase Allele Report: Dmel\smo[D16]

General Information

Symbol

Dmel\smo^D16

Species

D. melanogaster

Name

FlyBase ID

FBal0051131

Feature type

allele

Associated gene

Dmel\smo

Associated Insertion(s)

Carried in Construct

Key Links

Genomic Maps

JBrowse

Allele class

loss of function allele

Mutagen

gamma ray

Nature of the Allele

Allele class

loss of function allele

(Chen and Struhl, 1998)

Mutagen

gamma ray

(van den Heuvel and Ingham, 1996)

Progenitor genotype

Cytology

Description

Insertion of 38 base pairs after codon 124 that introduces two stop codons, one within and the other just downstream of the insertion. Codon 124 falls well before the first transmembrane domain.

(Chen and Struhl, 1998)

Mutations Mapped to the Genome

Curation Data

Type

Location

Additional Notes

References

insertion

2L:278,263..278,264 [+]

Inserted_sequence:

CATGATGAAATAACATGTTATTTCATCATGAGCTGAAC

Comment:

Insertion of 38 base pairs after codon 124 that introduces two stop codons, one within and the other just downstream of the insertion.

(Chen and Struhl, 1998)

Variant Molecular Consequences

Associated Sequence Data

DDBJ / EMBL / GenBank

DNA sequence

Protein sequence

UniProtKB/Swiss-Prot

UniProtKB/TrEMBL

Expression Data

Reporter Expression

Additional Information

Statement

Reference

Marker for

Reflects expression of

Reporter construct used in assay

Human Disease Associations

Disease Ontology (DO) Annotations

Models Based on Experimental Evidence ( 0 )

Disease

Evidence

References

Modifiers Based on Experimental Evidence ( 0 )

Disease

Interaction

References

Comments on Models/Modifiers Based on Experimental Evidence ( 0 )

Disease-implicated variant(s)

Phenotypic Data

Phenotypic Class

decreased cell number | somatic clone

(Dai et al., 2017)

decreased occurrence of cell division | larval stage | somatic clone

(Duman-Scheel et al., 2002)

lethal (with Df(2L)BSC454)

(Kahsai et al., 2016)

lethal | recessive

(van den Heuvel and Ingham, 1996)

Phenotype Manifest In

Detailed Description

Statement

Reference

The size of smo^D16 homozygous follicle cell clones in the germarium is significantly smaller than control clones.

(Dai et al., 2017)

Follicle stem cell clones homozygous for smo^D16 are present at a much lower frequency than control clones at 7 days (25% vs 73%) and 14 days (6% vs 57%) after clone induction.

(Vied and Kalderon, 2009)

Homozygous cells in the morphogenetic furrow (in clones that encompass the morphogenetic furrow) show a significant impairment in apical constriction.

(Corrigall et al., 2007)

Unlike neutral somatic clones, smo^D16 homozygous somatic clones are rapidly lost from the somatic stem cell population of the germarium so that, by 3 weeks after clone induction, none remain.

(Kirilly et al., 2005)

When smo^D16 clones are made in the posterior margin of the eye disc, clones lack photoreceptor differentiation.

(Pappu et al., 2003)

Somatic clones of smo^D16 in the ocellar triangle (ocellar cuticle) lead to reduced or absent ocelli. The medial ocellus is occasionally split in two.

(Thomas and Ingham, 2003)

Cells in clones in the eye disc fail to enter S phase in the second mitotic wave.

(Duman-Scheel et al., 2002)

Embryos derived from germline clone females exhibit loss of naked cuticle and polarity of the embryo is lost.

(van den Heuvel and Ingham, 1996)

External Data

Linkouts

Interactions

Show genetic interaction network for Enhancers & Suppressors

Phenotypic Class

Suppressor of

Statement

Reference

smo[+]/smo^D16 is a suppressor of visible phenotype of Scer\GAL4^Bx-MS1096, fu^{UAS.Tag:Palm(hGAP43),CFP}

(Claret et al., 2007)

Phenotype Manifest In

NOT Enhanced by

Statement

Reference

smo^D16 has eye disc | somatic clone phenotype, non-enhanceable by dpp^UAS.cSa/Scer\GAL4^ey.PB

(Pappu et al., 2003)

smo^D16 has eye disc morphogenetic furrow | somatic clone phenotype, non-enhanceable by dpp^UAS.cSa/Scer\GAL4^ey.PB

(Pappu et al., 2003)

smo^D16 has photoreceptor neuron | somatic clone phenotype, non-enhanceable by Scer\GAL4^ey.PB/so^UAS.cPa/eya^UAS.cPa

(Pappu et al., 2003)

smo^D16 has photoreceptor neuron | somatic clone phenotype, non-enhanceable by dpp^UAS.cSa/Scer\GAL4^ey.PB

(Pappu et al., 2003)

smo^D16 has eye disc | somatic clone phenotype, non-enhanceable by Scer\GAL4^ey.PB/eya^UAS.cPa

(Pappu et al., 2003)

smo^D16 has eye disc morphogenetic furrow | somatic clone phenotype, non-enhanceable by Scer\GAL4^ey.PB/eya^UAS.cPa

(Pappu et al., 2003)

smo^D16 has photoreceptor neuron | somatic clone phenotype, non-enhanceable by Scer\GAL4^ey.PB/eya^UAS.cPa

(Pappu et al., 2003)

smo^D16 has eye disc | somatic clone phenotype, non-enhanceable by dpp^UAS.cSa/Scer\GAL4^ey.PB/so^UAS.cPa

(Pappu et al., 2003)

smo^D16 has photoreceptor neuron | somatic clone phenotype, non-enhanceable by dpp^UAS.cSa/Scer\GAL4^ey.PB/so^UAS.cPa

(Pappu et al., 2003)

smo^D16 has eye disc | somatic clone phenotype, non-enhanceable by Scer\GAL4^ey.PB/so^UAS.cPa/eya^UAS.cPa

(Pappu et al., 2003)

smo^D16 has eye disc morphogenetic furrow | somatic clone phenotype, non-enhanceable by Scer\GAL4^ey.PB/so^UAS.cPa/eya^UAS.cPa

(Pappu et al., 2003)

Suppressed by

Statement

Reference

smo^D16 has eye disc | somatic clone phenotype, suppressible by Scer\GAL4^ey.PB/so^UAS.cPa/eya^UAS.cPa

(Pappu et al., 2003)

smo^D16 has photoreceptor neuron | somatic clone phenotype, suppressible by dpp^UAS.cSa/Scer\GAL4^ey.PB/eya^UAS.cPa

(Pappu et al., 2003)

smo^D16 has eye disc morphogenetic furrow | somatic clone phenotype, suppressible by dpp^UAS.cSa/Scer\GAL4^ey.PB/eya^UAS.cPa

(Pappu et al., 2003)

NOT suppressed by

Statement

Reference

smo^D16 has follicle stem cell | somatic clone phenotype, non-suppressible by Scer\GAL4^Act5C.PI/tkv^Q199D.UAS

(Kirilly et al., 2005)

smo^D16 has eye disc | somatic clone phenotype, non-suppressible by dpp^UAS.cSa/Scer\GAL4^ey.PB

(Pappu et al., 2003)

smo^D16 has eye disc morphogenetic furrow | somatic clone phenotype, non-suppressible by dpp^UAS.cSa/Scer\GAL4^ey.PB

(Pappu et al., 2003)

smo^D16 has photoreceptor neuron | somatic clone phenotype, non-suppressible by Scer\GAL4^ey.PB/so^UAS.cPa/eya^UAS.cPa

(Pappu et al., 2003)

smo^D16 has photoreceptor neuron | somatic clone phenotype, non-suppressible by dpp^UAS.cSa/Scer\GAL4^ey.PB

(Pappu et al., 2003)

smo^D16 has eye disc | somatic clone phenotype, non-suppressible by Scer\GAL4^ey.PB/eya^UAS.cPa

(Pappu et al., 2003)

smo^D16 has eye disc morphogenetic furrow | somatic clone phenotype, non-suppressible by Scer\GAL4^ey.PB/eya^UAS.cPa

(Pappu et al., 2003)

smo^D16 has photoreceptor neuron | somatic clone phenotype, non-suppressible by Scer\GAL4^ey.PB/eya^UAS.cPa

(Pappu et al., 2003)

smo^D16 has eye disc | somatic clone phenotype, non-suppressible by dpp^UAS.cSa/Scer\GAL4^ey.PB/so^UAS.cPa

(Pappu et al., 2003)

smo^D16 has photoreceptor neuron | somatic clone phenotype, non-suppressible by dpp^UAS.cSa/Scer\GAL4^ey.PB/so^UAS.cPa

(Pappu et al., 2003)

smo^D16 has eye disc | somatic clone phenotype, non-suppressible by Scer\GAL4^ey.PB/so^UAS.cPa/eya^UAS.cPa

(Pappu et al., 2003)

smo^D16 has eye disc morphogenetic furrow | somatic clone phenotype, non-suppressible by Scer\GAL4^ey.PB/so^UAS.cPa/eya^UAS.cPa

(Pappu et al., 2003)

Enhancer of

Statement

Reference

smo^D16 is an enhancer of eye phenotype of hid^GMR.PG

(Christiansen et al., 2013)

Suppressor of

Statement

Reference

smo[+]/smo^D16 is a suppressor of wing phenotype of Scer\GAL4^Bx-MS1096, fu^{UAS.Tag:Palm(hGAP43),CFP}

(Claret et al., 2007)

smo^D16 is a suppressor of phenotype of slmb^e4-1

(Theodosiou et al., 1998)

smo^D16 is a suppressor of phenotype of slmb⁰⁵⁴¹⁵

(Theodosiou et al., 1998)

Additional Comments

Genetic Interactions

Statement

Reference

Eyes mosaic for smo^D16 (generated using the ey-FLP/FRT system) enhance the W^GMR.PG eye phenotype.

(Christiansen et al., 2013)

smo^D16/+ restores an almost wild-type wing phenotype in animals expressing fu^{Scer\UAS.T:Hsap\Myr2,T:Avic\GFP-CFP} under the control of Scer\GAL4^Bx-MS1096.

(Claret et al., 2007)

The rapid loss of smo^D16 homozygous somatic clone cells from the somatic stem cell population of the germarium is not significantly suppressed if the clone cells are also tkv^{Q199D.Scer\UAS}; Scer\GAL4^Act5C.PI (Scer\GAL80 method).

(Kirilly et al., 2005)

The addition of dpp^Scer\UAS.cSa or eya^Scer\UAS.cPa (driven by Scer\GAL4^ey.PB) to animals with smo^D16 clones in the eye disc has no effect on the photoreceptor differentiation phenotype seen in eye discs. The delayed progression of the morphogenetic furrow is also not affected. The addition of so^Scer\UAS.cPa and eya^Scer\UAS.cPa (driven by Scer\GAL4^ey.PB) to animals with smo^D16 clones in the eye disc has no effect on the photoreceptor differentiation phenotype seen in eye discs. The delayed progression of the morphogenetic furrow is also not affected. The addition of dpp^Scer\UAS.cSa and eya^Scer\UAS.cPa (driven by Scer\GAL4^ey.PB) to animals with smo^D16 clones in the eye disc, fully suppresses photoreceptor differentiation phenotype seen in eye discs. The delayed progression of the morphogenetic furrow is also rescued. If so^Scer\UAS.cPa is also added, posterior margin clones are still rescued, although ectopic anterior furrows are induced with high frequency. The addition of so^Scer\UAS.cPa and dpp^Scer\UAS.cSa (driven by Scer\GAL4^ey.PB) to animals with smo^D16 clones in the eye disc has no effect on the photoreceptor differentiation phenotype seen in eye discs.

(Pappu et al., 2003)

Suppresses slmb induced outgrowths in mutant clones.

(Theodosiou et al., 1998)

Xenogenetic Interactions

Statement

Reference

Complementation and Rescue Data

Rescued by

smo^D16 is rescued by smo^+t6.2

(Chen and Struhl, 1998)

Not rescued by

smo^D16 is not rescued by smo^C155Y

(Chen and Struhl, 1998)

Comments

Images (0)

Mutant

Wild-type

Stocks (2)

Bloomington

51292

w^*; smo^D16 P{neoFRT}42D mam¹⁰/CyO, P{ActGFP}JMR1

51291

w^*; smo^D16 P{neoFRT}42D mam¹⁰ Egfr^f24/CyO, P{ActGFP}JMR1

Notes on Origin

Discoverer

Comments

Likely to be a null allele.

(Chen and Struhl, 1998)

External Crossreferences and Linkouts ( 0 )

Synonyms and Secondary IDs (2)

Reported As

Symbol Synonym

smo^D16

(Gonçalves Antunes et al., 2022, Dai et al., 2017, Avanesov and Blair, 2013, Christiansen et al., 2013, Li et al., 2013, Rojas-Ríos et al., 2012, Baker et al., 2009, Vied and Kalderon, 2009, Claret et al., 2007, Corrigall et al., 2007, Malpel et al., 2007, Sisson et al., 2006, Kirilly et al., 2005)

smo^d16

(Atkins et al., 2013, Blanco et al., 2009, Pappu et al., 2003)

Name Synonyms

Secondary FlyBase IDs

References (29)

Report Sections

Open Close