Allele Dmel\y^{P1\loxP.su(Hw)BR-y-AS-C.-900}

General Information
Symbol	Dmel\y^{P1\loxP.su(Hw)BR-y-AS-C.-900}	Species	D. melanogaster
Name		FlyBase ID	FBal0151315
Feature type	allele	Associated gene	Dmel\y

Allele class
Mutagen	in vitro construct - regulatory fusion
Recent Updates
Description	What does this section display? This section contains items that were added to this record for each release. It currently only tracks new links between this FlyBase report and other FlyBase data classes (e.g. genes, references, stocks) or controlled vocabulary terms (e.g. GO, anatomy terms). What does this section not display? This section does not currently display links that were removed or gene model changes.
Update Feed	Click the icon below to subscribe to this FlyBase record and receive updates automatically through your feed reader.
FB2013_03
FB2013_02
All updates	Click here to see a list of all updates to this record from FB2010_08 and on.
Nature of the Allele
Allele class
Mutagen	in vitro construct - regulatory fusion (Parnell et al., 2003)
Mutations Mapped to the Genome

Type Location Additional Notes References
Associated Sequence Data
DDBJ / EMBL / GenBank	DNA sequence Protein sequence Name

UniProtKB/Swiss-Prot
UniProtKB/TrEMBL

Progenitor genotype
Nature of the lesion	Statement Reference Construct: y^{P1\loxP.su(Hw)BR-y-AS-C.-900} contains the y gene including upstream regulatory regions, into which the su(Hw)BR-y-AS-C (a 250 bp fragment PCR amplified from genomic DNA using the primers TTTGAAGGTTAAGAGTTTACG and CTTCGTCTACCGTTGTGC) flanked by P1\loxP sites, is inserted 900 bp upstream of the y transcriptional start site. (Parnell et al., 2003)
Carried in construct	P{y(loxP.su(Hw)BR-y-AS-C)-y} (Parnell et al., 2003)
Cytology
Phenotypic Data
Phenotypic Class
	body color defective, with y¹ (Parnell et al., 2003) visible, with y¹ (Parnell et al., 2003)
Phenotype Manifest In

Detailed Description
	Statement Reference y¹/y¹; y^{P1\loxP.su(Hw)BR-y-AS-C.-900} females have low levels of wing and body pigmentation, and wild-type levels of bristle and tarsal claw pigmentation. (Parnell et al., 2003)
External Data
Linkouts
Interactions
Phenotypic Class
NOT Enhanced by
Statement Reference y¹, y^{P1\loxP.su(Hw)BR-y-AS-C.-900} has body color defective phenotype, non-enhanceable by Df(3R)su(Hw)V/su(Hw)⁷ (Parnell et al., 2003) y¹, y^{P1\loxP.su(Hw)BR-y-AS-C.-900} has visible phenotype, non-enhanceable by Df(3R)su(Hw)V/su(Hw)⁷ (Parnell et al., 2003)
NOT suppressed by
Statement Reference y¹, y^{P1\loxP.su(Hw)BR-y-AS-C.-900} has body color defective phenotype, non-suppressible by Df(3R)su(Hw)V/su(Hw)⁷ (Parnell et al., 2003) y¹, y^{P1\loxP.su(Hw)BR-y-AS-C.-900} has visible phenotype, non-suppressible by Df(3R)su(Hw)V/su(Hw)⁷ (Parnell et al., 2003)
Phenotype Manifest In
Additional Comments
Genetic Interactions
Statement Reference Pigmentation of y¹/y¹; y^{P1\loxP.su(Hw)BR-y-AS-C.-900} animals is largely unaffected by a su(Hw)⁷/Df(3R)su(Hw)V background. (Parnell et al., 2003)
Xenogenetic Interactions
Statement Reference
Complementation & Rescue Data
Comments
Stocks ( 0 )

Notes on Origin
Discoverer

External Crossreferences & Linkouts
Other Crossreferences

Linkouts

Synonyms & Secondary IDs ( 1 )
Reported As
Symbol Synonym	y^{P1\loxP.su(Hw)BR-y-AS-C.-900}
Name Synonym
Secondary FlyBase IDs

References ( 1 )
Research paper	Parnell et al., 2003, Proc. Natl. Acad. Sci. U.S.A. 100(23): 13436--13441 An endogenous Suppressor of Hairy-wing insulator separates regulatory domains in Drosophila. [FBrf0168001]

Allele Dmel\yP1\loxP.su(Hw)BR-y-AS-C.-900

Allele Dmel\y^{P1\loxP.su(Hw)BR-y-AS-C.-900}