Open Close
General Information
Symbol
Dmel\Hr4dsRNA.hs
Species
D. melanogaster
Name
FlyBase ID
FBal0191919
Feature type
allele
Associated gene
Associated Insertion(s)
Carried in Construct
Allele class
Nature of the Allele
Allele class
Mutations Mapped to the Genome
 
Type
Location
Additional Notes
References
Associated Sequence Data
DNA sequence
Protein sequence
 
 
Progenitor genotype
Carried in construct
Cytology
Nature of the lesion
Statement
Reference

Heat shock promoter sequences drive expression of an inverted repeat of Hr4 made by ligating two BspEI digested Hr4 cDNA fragments amplified using PCR primer GTTCGTCTAGAGACCGACAGATCTCGTACGAGCACGCC with TTGCTGTCCGGAGCCGCTCCGGGATCGTATCAGGACCAGG or TCTTCAAAATGGACGTGGATGCGGCTGAGG.

Allele components
Product class / Tool use(s)
Regulatory region(s)
Encoded product / tool
Expression Data
Reporter Expression
Additional Information
Statement
Reference
 
Marker for
Reflects expression of
Reporter construct used in assay
Human Disease Associations
Disease Ontology (DO) Annotations
Models Based on Experimental Evidence ( 0 )
Disease
Evidence
References
Modifiers Based on Experimental Evidence ( 0 )
Disease
Interaction
References
Comments on Models/Modifiers Based on Experimental Evidence ( 0 )
 
Phenotypic Data
Phenotypic Class
Phenotype Manifest In
Detailed Description
Statement
Reference

Heat treatment of Hr4dsRNA.hs larvae in late L2 results in precocious wandering behavior. Heat treatment in early L3 has no effect in addition, a small percentage of dwarf larvae are found in late L2-treated larvae.

Heat shock of Hr4dsRNA.hs animals during the first or second instar has no significant effect on viability. But heat shocking these animals 12 hours prior to pupariation causes significant prepupal (63%) and pupal (35%) lethality, with only 2% of the animals eclosing. Heat shock of 0-3 hour old larvae results in significant growth defects: 20% of pupae developing to 60-70% of wild-type length (n = 100), and a moderate reduction in size in 75% of the population (Figure 2B). In contrast to Hr41 mutants, of these small pupae continue to develop and form small, viable flies.

External Data
Interactions
Show genetic interaction network for Enhancers & Suppressors
Phenotypic Class
Phenotype Manifest In
Additional Comments
Genetic Interactions
Statement
Reference
Xenogenetic Interactions
Statement
Reference
Complementation and Rescue Data
Comments
Images (0)
Mutant
Wild-type
Stocks (0)
Notes on Origin
Discoverer
Comments
Comments

Transcription from the P{hs-Hr4.RNAi} construct should produce Hr4 dsRNA, resulting in dsRNA interference (RNAi) of the Hr4 gene.

External Crossreferences and Linkouts ( 0 )
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
Hr4dsRNA.hs
Name Synonyms
Secondary FlyBase IDs
    References (2)