Expression of a GAL4 driver is under the control of 2 genomic sequences from upstream of srp amplified with AGGGTACCCTACTGCTTCCCACTCTAAGACTTCCAGTTTTAGGCTACG (sense) and GGAATTCGGCAATGCCCCACCCCTTGGCTGGACGG (antisense) as well as CGCGGTACCCAGCGGGAGCAACAGGATCAAATGCAGCAGCG (sense) and CGCGGTACCTATGGGATCCGTGCTGGGGTAGTGCTCGTAGAGC (antisense).
Comment: from 48 hr AEL
Drives expression in hemocytes and pericardial cells (nephrocytes) from embryonic stage 9 through all larval stages.
ScerGAL4srp.Hemo drives expression in nephrocytes and hemocytes
ScerGAL4srp.Hemo drives expression in all hemocytes and macrophages at all embryonic stages, as well as in the head mesoderm that gives rise to hemocytes beginning at embryonic stage 9.
Scer\GAL4srp.Hemo, TM4SFKK111096 has decreased cell number | embryonic stage phenotype, enhanceable by cherKK107518/Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, cherKK107518 has decreased cell number | embryonic stage phenotype, non-enhanceable by TM4SFKK111096/Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, kayFbz.UAS has abnormal cell number | embryonic stage phenotype, non-enhanceable by cherUAS.Tag:FLAG/Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, kayFbz.UAS has abnormal cell number | embryonic stage phenotype, suppressible by diaΔDad.UASp.EGFP/Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, kayFbz.UAS has abnormal cell number | embryonic stage phenotype, suppressible by diaHMS00308/LamGD1478, Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, kayFbz.UAS has abnormal cell number | embryonic stage phenotype, suppressible by LamCJF01406/diaHMS00308, Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, kayFbz.UAS has abnormal cell number | embryonic stage phenotype, suppressible by diaHMS00308/LamKK102399, Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, kayFbz.UAS has abnormal cell number | embryonic stage phenotype, suppressible by TM4SFUAS.cBa/Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, atosGD14092 has abnormal cell migration | embryonic stage phenotype, suppressible by pthsUAS.Tag:FLAG,Tag:HA/Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, atosGD14092 has abnormal cell migration | embryonic stage phenotype, suppressible | partially by pthsΔnls.UAS.Tag:FLAG,Tag:HA/Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, pthsGD14168 has abnormal cell migration | embryonic stage phenotype, suppressible by Nprl2GD4298, Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, pthsGD14168 has abnormal cell migration | embryonic stage phenotype, suppressible by Iml1GD7476, Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, pthsGD14168 has abnormal cell migration | embryonic stage phenotype, suppressible by Tsc1JF01484/Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, atosGD14092 has abnormal cell migration | embryonic stage phenotype, suppressible by Nprl2GD4298, Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, atosGD14092 has abnormal cell migration | embryonic stage phenotype, suppressible by Tsc1JF01484/Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, atosGD14092 has abnormal cell migration | embryonic stage phenotype, suppressible by Iml1GD7476, Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, kayFbz.UAS has abnormal cell number | embryonic stage phenotype, non-suppressible by cherUAS.Tag:FLAG/Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, cherKK107518 has decreased cell number | embryonic stage phenotype, non-suppressible by TM4SFKK111096/Scer\GAL4srp.Hemo
gcmJF01075/Scer\GAL4srp.Hemo is an enhancer of melanotic mass phenotype | larval stage | dominant phenotype of Tl10b
cherKK107518/Scer\GAL4srp.Hemo is an enhancer of decreased cell number | embryonic stage phenotype of Scer\GAL4srp.Hemo, TM4SFKK111096
TM4SFKK111096/Scer\GAL4srp.Hemo is a non-enhancer of decreased cell number | embryonic stage phenotype of Scer\GAL4srp.Hemo, cherKK107518
cherUAS.Tag:FLAG/Scer\GAL4srp.Hemo is a non-enhancer of abnormal cell number | embryonic stage phenotype of Scer\GAL4srp.Hemo, kayFbz.UAS
diaΔDad.UASp.EGFP/Scer\GAL4srp.Hemo is a suppressor of decreased cell number | embryonic stage phenotype of kay1
diaΔDad.UASp.EGFP/Scer\GAL4srp.Hemo is a suppressor of decreased cell number | embryonic stage phenotype of kay2
diaΔDad.UASp.EGFP/Scer\GAL4srp.Hemo is a suppressor of abnormal cell number | embryonic stage phenotype of Scer\GAL4srp.Hemo, kayFbz.UAS
diaHMS00308/LamGD1478, Scer\GAL4srp.Hemo is a suppressor of abnormal cell number | embryonic stage phenotype of Scer\GAL4srp.Hemo, kayFbz.UAS
LamCJF01406/diaHMS00308, Scer\GAL4srp.Hemo is a suppressor of abnormal cell number | embryonic stage phenotype of Scer\GAL4srp.Hemo, kayFbz.UAS
diaHMS00308/LamKK102399, Scer\GAL4srp.Hemo is a suppressor of abnormal cell number | embryonic stage phenotype of Scer\GAL4srp.Hemo, kayFbz.UAS
TM4SFUAS.cBa/Scer\GAL4srp.Hemo is a suppressor of abnormal cell number | embryonic stage phenotype of Scer\GAL4srp.Hemo, kayFbz.UAS
Iml1GD7476, Scer\GAL4srp.Hemo is a suppressor of abnormal cell migration | embryonic stage phenotype of Scer\GAL4srp.Hemo, atosGD14092
pthsUAS.Tag:FLAG,Tag:HA/Scer\GAL4srp.Hemo is a suppressor of abnormal cell migration | embryonic stage phenotype of Scer\GAL4srp.Hemo, atosGD14092
pthsΔnls.UAS.Tag:FLAG,Tag:HA/Scer\GAL4srp.Hemo is a suppressor | partially of abnormal cell migration | embryonic stage phenotype of Scer\GAL4srp.Hemo, atosGD14092
Nprl2GD4298, Scer\GAL4srp.Hemo is a suppressor of abnormal cell migration | embryonic stage phenotype of Scer\GAL4srp.Hemo, pthsGD14168
Iml1GD7476, Scer\GAL4srp.Hemo is a suppressor of abnormal cell migration | embryonic stage phenotype of Scer\GAL4srp.Hemo, pthsGD14168
Tsc1JF01484/Scer\GAL4srp.Hemo is a suppressor of abnormal cell migration | embryonic stage phenotype of Scer\GAL4srp.Hemo, pthsGD14168
pthsUAS.Tag:FLAG,Tag:HA/Scer\GAL4srp.Hemo is a suppressor of abnormal cell migration | embryonic stage phenotype of atosBG02278
CG9331UAS.Tag:FLAG,Tag:HA/Scer\GAL4srp.Hemo is a suppressor of abnormal cell migration | embryonic stage phenotype of atosBG02278
LKRSDHUAS.Tag:FLAG,Tag:HA/Scer\GAL4srp.Hemo is a suppressor | partially of abnormal cell migration | embryonic stage phenotype of atosBG02278
Nprl2GD4298, Scer\GAL4srp.Hemo is a suppressor of abnormal cell migration | embryonic stage phenotype of Scer\GAL4srp.Hemo, atosGD14092
Tsc1JF01484/Scer\GAL4srp.Hemo is a suppressor of abnormal cell migration | embryonic stage phenotype of Scer\GAL4srp.Hemo, atosGD14092
Scer\GAL4srp.Hemo/BacA\p35UAS.cHa is a suppressor of increased cell death | recessive phenotype of Pvr1
cherUAS.Tag:FLAG/Scer\GAL4srp.Hemo is a non-suppressor of abnormal cell number | embryonic stage phenotype of Scer\GAL4srp.Hemo, kayFbz.UAS
TM4SFKK111096/Scer\GAL4srp.Hemo is a non-suppressor of decreased cell number | embryonic stage phenotype of Scer\GAL4srp.Hemo, cherKK107518
Scer\GAL4srp.Hemo, TM4SFKK111096 has embryonic/larval plasmatocyte | embryonic stage | decreased number phenotype, enhanceable by cherKK107518/Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, TM4SFKK111096 has germ band phenotype, enhanceable by cherKK107518/Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, kayFbz.UAS has embryonic/larval plasmatocyte | embryonic stage phenotype, non-enhanceable by cherUAS.Tag:FLAG/Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, cherKK107518 has embryonic/larval plasmatocyte | embryonic stage | decreased number phenotype, non-enhanceable by TM4SFKK111096/Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, cherKK107518 has germ band phenotype, non-enhanceable by TM4SFKK111096/Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, kayFbz.UAS has germ band phenotype, non-enhanceable by cherUAS.Tag:FLAG/Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, kayFbz.UAS has embryonic/larval plasmatocyte | embryonic stage phenotype, suppressible by diaΔDad.UASp.EGFP/Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, kayFbz.UAS has germ band phenotype, suppressible by diaΔDad.UASp.EGFP/Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, kayFbz.UAS has embryonic/larval plasmatocyte | embryonic stage phenotype, suppressible by diaHMS00308/LamGD1478, Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, kayFbz.UAS has embryonic/larval plasmatocyte | embryonic stage phenotype, suppressible by diaHMS00308/LamKK102399, Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, kayFbz.UAS has embryonic/larval plasmatocyte | embryonic stage phenotype, suppressible by LamCJF01406/diaHMS00308, Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, kayFbz.UAS has embryonic/larval plasmatocyte | embryonic stage phenotype, suppressible by TM4SFUAS.cBa/Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, kayFbz.UAS has germ band phenotype, suppressible by TM4SFUAS.cBa/Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, kayFbz.UAS has germ band phenotype, suppressible by diaHMS00308/LamGD1478, Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, kayFbz.UAS has germ band phenotype, suppressible by diaHMS00308/LamKK102399, Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, kayFbz.UAS has germ band phenotype, suppressible by LamCJF01406/diaHMS00308, Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, pthsGD14168 has embryonic/larval plasmatocyte | embryonic stage phenotype, suppressible by Nprl2GD4298, Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, pthsGD14168 has embryonic/larval plasmatocyte | embryonic stage phenotype, suppressible by Tsc1JF01484/Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, pthsGD14168 has germ band phenotype, suppressible by Tsc1JF01484/Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, pthsGD14168 has germ band phenotype, suppressible by Nprl2GD4298, Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, pthsGD14168 has embryonic/larval plasmatocyte | embryonic stage phenotype, suppressible by Iml1GD7476, Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, pthsGD14168 has germ band phenotype, suppressible by Iml1GD7476, Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, atosGD14092 has embryonic/larval plasmatocyte | embryonic stage phenotype, suppressible by Nprl2GD4298, Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, atosGD14092 has embryonic/larval plasmatocyte | embryonic stage phenotype, suppressible by Iml1GD7476, Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, atosGD14092 has embryonic/larval plasmatocyte | embryonic stage phenotype, suppressible by Tsc1JF01484/Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, atosGD14092 has germ band phenotype, suppressible by Nprl2GD4298, Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, atosGD14092 has germ band phenotype, suppressible by Tsc1JF01484/Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, atosGD14092 has germ band phenotype, suppressible by Iml1GD7476, Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, atosGD14092 has embryonic/larval plasmatocyte | embryonic stage phenotype, suppressible by pthsUAS.Tag:FLAG,Tag:HA/Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, atosGD14092 has germ band phenotype, suppressible by pthsUAS.Tag:FLAG,Tag:HA/Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, atosGD14092 has embryonic/larval plasmatocyte | embryonic stage phenotype, suppressible | partially by pthsΔnls.UAS.Tag:FLAG,Tag:HA/Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, atosGD14092 has germ band phenotype, suppressible | partially by pthsΔnls.UAS.Tag:FLAG,Tag:HA/Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, kayFbz.UAS has embryonic/larval plasmatocyte | embryonic stage phenotype, non-suppressible by cherUAS.Tag:FLAG/Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, cherKK107518 has germ band phenotype, non-suppressible by TM4SFKK111096/Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, kayFbz.UAS has germ band phenotype, non-suppressible by cherUAS.Tag:FLAG/Scer\GAL4srp.Hemo
Scer\GAL4srp.Hemo, cherKK107518 has embryonic/larval plasmatocyte | embryonic stage | decreased number phenotype, non-suppressible by TM4SFKK111096/Scer\GAL4srp.Hemo
cherKK107518/Scer\GAL4srp.Hemo is an enhancer of embryonic/larval plasmatocyte | embryonic stage | decreased number phenotype of Scer\GAL4srp.Hemo, TM4SFKK111096
cherKK107518/Scer\GAL4srp.Hemo is an enhancer of germ band phenotype of Scer\GAL4srp.Hemo, TM4SFKK111096
cherUAS.Tag:FLAG/Scer\GAL4srp.Hemo is a non-enhancer of embryonic/larval plasmatocyte | embryonic stage phenotype of Scer\GAL4srp.Hemo, kayFbz.UAS
TM4SFKK111096/Scer\GAL4srp.Hemo is a non-enhancer of embryonic/larval plasmatocyte | embryonic stage | decreased number phenotype of Scer\GAL4srp.Hemo, cherKK107518
TM4SFKK111096/Scer\GAL4srp.Hemo is a non-enhancer of germ band phenotype of Scer\GAL4srp.Hemo, cherKK107518
cherUAS.Tag:FLAG/Scer\GAL4srp.Hemo is a non-enhancer of germ band phenotype of Scer\GAL4srp.Hemo, kayFbz.UAS
diaΔDad.UASp.EGFP/Scer\GAL4srp.Hemo is a suppressor of embryonic/larval plasmatocyte | embryonic stage | decreased number phenotype of kay1
diaΔDad.UASp.EGFP/Scer\GAL4srp.Hemo is a suppressor of germ band phenotype of kay1
diaΔDad.UASp.EGFP/Scer\GAL4srp.Hemo is a suppressor of embryonic/larval plasmatocyte | embryonic stage | decreased number phenotype of kay2
diaΔDad.UASp.EGFP/Scer\GAL4srp.Hemo is a suppressor of germ band phenotype of kay2
diaΔDad.UASp.EGFP/Scer\GAL4srp.Hemo is a suppressor of embryonic/larval plasmatocyte | embryonic stage phenotype of Scer\GAL4srp.Hemo, kayFbz.UAS
diaΔDad.UASp.EGFP/Scer\GAL4srp.Hemo is a suppressor of germ band phenotype of Scer\GAL4srp.Hemo, kayFbz.UAS
diaHMS00308/LamGD1478, Scer\GAL4srp.Hemo is a suppressor of embryonic/larval plasmatocyte | embryonic stage phenotype of Scer\GAL4srp.Hemo, kayFbz.UAS
diaHMS00308/LamKK102399, Scer\GAL4srp.Hemo is a suppressor of embryonic/larval plasmatocyte | embryonic stage phenotype of Scer\GAL4srp.Hemo, kayFbz.UAS
LamCJF01406/diaHMS00308, Scer\GAL4srp.Hemo is a suppressor of embryonic/larval plasmatocyte | embryonic stage phenotype of Scer\GAL4srp.Hemo, kayFbz.UAS
TM4SFUAS.cBa/Scer\GAL4srp.Hemo is a suppressor of embryonic/larval plasmatocyte | embryonic stage phenotype of Scer\GAL4srp.Hemo, kayFbz.UAS
TM4SFUAS.cBa/Scer\GAL4srp.Hemo is a suppressor of germ band phenotype of Scer\GAL4srp.Hemo, kayFbz.UAS
diaHMS00308/LamGD1478, Scer\GAL4srp.Hemo is a suppressor of germ band phenotype of Scer\GAL4srp.Hemo, kayFbz.UAS
diaHMS00308/LamKK102399, Scer\GAL4srp.Hemo is a suppressor of germ band phenotype of Scer\GAL4srp.Hemo, kayFbz.UAS
LamCJF01406/diaHMS00308, Scer\GAL4srp.Hemo is a suppressor of germ band phenotype of Scer\GAL4srp.Hemo, kayFbz.UAS
Nprl2GD4298, Scer\GAL4srp.Hemo is a suppressor of embryonic/larval plasmatocyte | embryonic stage phenotype of Scer\GAL4srp.Hemo, pthsGD14168
Tsc1JF01484/Scer\GAL4srp.Hemo is a suppressor of embryonic/larval plasmatocyte | embryonic stage phenotype of Scer\GAL4srp.Hemo, pthsGD14168
Tsc1JF01484/Scer\GAL4srp.Hemo is a suppressor of germ band phenotype of Scer\GAL4srp.Hemo, pthsGD14168
Nprl2GD4298, Scer\GAL4srp.Hemo is a suppressor of germ band phenotype of Scer\GAL4srp.Hemo, pthsGD14168
Iml1GD7476, Scer\GAL4srp.Hemo is a suppressor of embryonic/larval plasmatocyte | embryonic stage phenotype of Scer\GAL4srp.Hemo, pthsGD14168
Iml1GD7476, Scer\GAL4srp.Hemo is a suppressor of germ band phenotype of Scer\GAL4srp.Hemo, pthsGD14168
pthsUAS.Tag:FLAG,Tag:HA/Scer\GAL4srp.Hemo is a suppressor of embryonic/larval plasmatocyte | embryonic stage phenotype of atosBG02278
pthsUAS.Tag:FLAG,Tag:HA/Scer\GAL4srp.Hemo is a suppressor of germ band phenotype of atosBG02278
LKRSDHUAS.Tag:FLAG,Tag:HA/Scer\GAL4srp.Hemo is a suppressor | partially of embryonic/larval plasmatocyte | embryonic stage phenotype of atosBG02278
CG9331UAS.Tag:FLAG,Tag:HA/Scer\GAL4srp.Hemo is a suppressor of embryonic/larval plasmatocyte | embryonic stage phenotype of atosBG02278
LKRSDHUAS.Tag:FLAG,Tag:HA/Scer\GAL4srp.Hemo is a suppressor | partially of germ band phenotype of atosBG02278
CG9331UAS.Tag:FLAG,Tag:HA/Scer\GAL4srp.Hemo is a suppressor of germ band phenotype of atosBG02278
Nprl2GD4298, Scer\GAL4srp.Hemo is a suppressor of embryonic/larval plasmatocyte | embryonic stage phenotype of Scer\GAL4srp.Hemo, atosGD14092
Iml1GD7476, Scer\GAL4srp.Hemo is a suppressor of embryonic/larval plasmatocyte | embryonic stage phenotype of Scer\GAL4srp.Hemo, atosGD14092
Tsc1JF01484/Scer\GAL4srp.Hemo is a suppressor of embryonic/larval plasmatocyte | embryonic stage phenotype of Scer\GAL4srp.Hemo, atosGD14092
Nprl2GD4298, Scer\GAL4srp.Hemo is a suppressor of germ band phenotype of Scer\GAL4srp.Hemo, atosGD14092
Tsc1JF01484/Scer\GAL4srp.Hemo is a suppressor of germ band phenotype of Scer\GAL4srp.Hemo, atosGD14092
Iml1GD7476, Scer\GAL4srp.Hemo is a suppressor of germ band phenotype of Scer\GAL4srp.Hemo, atosGD14092
pthsUAS.Tag:FLAG,Tag:HA/Scer\GAL4srp.Hemo is a suppressor of embryonic/larval plasmatocyte | embryonic stage phenotype of Scer\GAL4srp.Hemo, atosGD14092
pthsUAS.Tag:FLAG,Tag:HA/Scer\GAL4srp.Hemo is a suppressor of germ band phenotype of Scer\GAL4srp.Hemo, atosGD14092
pthsΔnls.UAS.Tag:FLAG,Tag:HA/Scer\GAL4srp.Hemo is a suppressor | partially of embryonic/larval plasmatocyte | embryonic stage phenotype of Scer\GAL4srp.Hemo, atosGD14092
pthsΔnls.UAS.Tag:FLAG,Tag:HA/Scer\GAL4srp.Hemo is a suppressor | partially of germ band phenotype of Scer\GAL4srp.Hemo, atosGD14092
dlUASp.cMa, Scer\GAL4srp.Hemo, dl1 is a suppressor of hemocyte phenotype of Dif1
dlUASp.cMa, Scer\GAL4srp.Hemo, dl1 is a suppressor of hemolymph phenotype of Dif1
Scer\GAL4srp.Hemo/BacA\p35UAS.cHa is a suppressor of embryonic/larval hemocyte phenotype of Pvr1
Ras85DV12.UAS/Scer\GAL4srp.Hemo is a suppressor | partially of embryonic/larval plasmatocyte | embryonic stage phenotype of Pvr1
Scer\GAL4srp.Hemo/Pi3K92EUAS.Tag:MYC,Tag:PM(hKRAS) is a suppressor | partially of embryonic/larval hemocyte phenotype of Pvr1
Scer\GAL4srp.Hemo/BacA\p35UAS.cHa is a suppressor of embryonic/larval plasmatocyte | embryonic stage phenotype of Pvr1
Scer\GAL4srp.Hemo/BacA\p35UAS.cHa is a suppressor | partially of embryonic/larval hemocyte phenotype of Pvr1
cherUAS.Tag:FLAG/Scer\GAL4srp.Hemo is a non-suppressor of embryonic/larval plasmatocyte | embryonic stage phenotype of Scer\GAL4srp.Hemo, kayFbz.UAS
TM4SFKK111096/Scer\GAL4srp.Hemo is a non-suppressor of germ band phenotype of Scer\GAL4srp.Hemo, cherKK107518
cherUAS.Tag:FLAG/Scer\GAL4srp.Hemo is a non-suppressor of germ band phenotype of Scer\GAL4srp.Hemo, kayFbz.UAS
TM4SFKK111096/Scer\GAL4srp.Hemo is a non-suppressor of embryonic/larval plasmatocyte | embryonic stage | decreased number phenotype of Scer\GAL4srp.Hemo, cherKK107518
snUASp.cZa/Scer\GAL4srp.Hemo partially rescues Df(1)C128
snUASp.EGFP/Scer\GAL4srp.Hemo partially rescues snX2
snS52A.UASp.EGFP/Scer\GAL4srp.Hemo partially rescues snX2
snS52E.UASp.EGFP/Scer\GAL4srp.Hemo partially rescues snX2
Pvrλ.UASp.Tag:MYC/Scer\GAL4srp.Hemo partially rescues Pvr1
Scer\GAL4crq.PA, PezΔFERM.UAS, Scer\GAL4srp.Hemo fails to rescue Pez2
Scer\GAL4srp.Hemo/drprY858F.UAS fails to rescue drprΔ5
prtpUAS.cKa/Scer\GAL4srp.Hemo fails to rescue prtpΔ1