Allele Ppyr\LUCsnRNA:U1:95Ca.mutPSEA
| General Information | |||
|---|---|---|---|
| Symbol | Ppyr\LUCsnRNA:U1:95Ca.mutPSEA | Species | P. pyralis |
| Name | FlyBase ID | FBal0215358 | |
| Feature type | allele | Associated gene | Ppyr\LUC |
| Allele class | |||
| Mutagen | in vitro construct - regulatory fusion, in vitro construct - site directed mutagenesis | ||
Recent Updates
|
|||
| Description |
What does this section display?
This section contains items that were added to this record for each release.
It currently only tracks new links between this FlyBase report and other
FlyBase data classes (e.g. genes, references, stocks) or controlled
vocabulary terms (e.g. GO, anatomy terms).
What does this section not display?
This section does not currently display links that were removed or gene model changes.
|
||
| Update Feed |
Click the icon below to subscribe to this FlyBase record and receive updates automatically through your
feed reader.
|
||
| FB2013_03 | |||
| FB2013_02 | |||
| All updates | Click here to see a list of all updates to this record from FB2010_08 and on. | ||
Nature of the Allele
| |||
| Allele class | |||
| Mutagen | |||
| Mutations Mapped to the Genome | |||
Type Location Additional Notes References | |||
| Associated Sequence Data | |||
| DDBJ
/
EMBL / GenBank | DNA sequence Protein sequence Name | ||
| UniProtKB/Swiss-Prot | |||
| UniProtKB/TrEMBL | |||
| Progenitor genotype | |||
| Nature of the lesion | Statement Reference snRNA:U1:95Ca sequences from -381 to +32bp, with a mutated PSEA sequence, are fused upstream of the Ppyr\LUC coding region. The PSEA sequence has been changed from TAATTCCCAACTGGTTTTAGC to CCTGATAGGTGACCAGGACTA. | ||
| Cytology | |||
Phenotypic Data
| |||
Phenotypic Class
| |||
Phenotype Manifest In
| |||
Detailed Description
| |||
Statement Reference | |||
External Data
| |||
| Linkouts | |||
Interactions
| |||
Phenotypic Class
| |||
Phenotype Manifest In
| |||
Additional Comments
| |||
Genetic Interactions
| |||
Statement Reference | |||
Xenogenetic Interactions
| |||
Statement Reference | |||
Complementation & Rescue Data
| |||
| Comments | |||
Stocks
( 0 ) | |||
Notes on Origin
| |||
| Discoverer | |||
Comments
| |||
Carried in a plasmid, transfected into S2 cells and used to study U1 promoter efficiency. | |||
External Crossreferences & Linkouts
| |||
| Other Crossreferences | |||
| Linkouts | |||
Synonyms & Secondary IDs
( 1 ) | |||
| Reported As | |||
| Symbol Synonym | Ppyr\LUCsnRNA:U1:95Ca.mutPSEA | ||
| Name Synonym | |||
| Secondary FlyBase IDs | |||
References
( 1 ) | |||
| Research paper |
| ||
Recent Updates
External Crossreferences & Linkouts