Open Close
General Information
Symbol
Dmel\Hr4dsRNA.UAS
Species
D. melanogaster
Name
FlyBase ID
FBal0282373
Feature type
allele
Associated gene
Associated Insertion(s)
Carried in Construct
Allele class
Nature of the Allele
Allele class
Mutations Mapped to the Genome
 
Type
Location
Additional Notes
References
Associated Sequence Data
DNA sequence
Protein sequence
 
 
Progenitor genotype
Carried in construct
Cytology
Nature of the lesion
Statement
Reference

UAS regulatory sequences drive expression of an inverted repeat of Hr4 made by ligating two BspEI digested Hr4 cDNA fragments amplified using PCR primer GTTCGTCTAGAGACCGACAGATCTCGTACGAGCACGCC with TTGCTGTCCGGAGCCGCTCCGGGATCGTATCAGGACCAGG or TCTTCAAAATGGACGTGGATGCGGCTGAGG.

Allele components
Product class / Tool use(s)
Encoded product / tool
Expression Data
Reporter Expression
Additional Information
Statement
Reference
 
Marker for
Reflects expression of
Reporter construct used in assay
Human Disease Associations
Disease Ontology (DO) Annotations
Models Based on Experimental Evidence ( 0 )
Disease
Evidence
References
Modifiers Based on Experimental Evidence ( 0 )
Disease
Interaction
References
Comments on Models/Modifiers Based on Experimental Evidence ( 0 )
 
Phenotypic Data
Phenotypic Class
Phenotype Manifest In
Detailed Description
Statement
Reference

Expression of Hr4dsRNA.Scer\UAS in the ring gland, under the control of Scer\GAL4P0206 triggers phenotypes consistent with early larval wandering and results in early pupariation and small precocious prepupae.

Expression of Hr4dsRNA.Scer\UAS in the fat body, under the control of Scer\GAL4Cg.PA results in prepupal lethality in approximately 10% of the population. There is also a failure to evert anterior spiracles, incomplete or absent head eversion, and incorrect location of the gas bubble in these flies, indicative of a defect in ecdysone hierarchy. These flies do not exhibit any timing defects or abnormally sized pupae.

External Data
Interactions
Show genetic interaction network for Enhancers & Suppressors
Phenotypic Class
Phenotype Manifest In
Additional Comments
Genetic Interactions
Statement
Reference
Xenogenetic Interactions
Statement
Reference
Complementation and Rescue Data
Comments
Images (0)
Mutant
Wild-type
Stocks (0)
Notes on Origin
Discoverer
External Crossreferences and Linkouts ( 0 )
Synonyms and Secondary IDs (2)
Reported As
Symbol Synonym
Hr4dsRNA.Scer\UAS
Hr4dsRNA.UAS
Name Synonyms
Secondary FlyBase IDs
    References (1)