Imprecise excision of P{SUPor-P}lolaKG09113 has resulted in a 20bp insertion within the acal transcript.
Imprecise excision of P{SUPor-P}lolaKG09113 resulted in a 20 bp insertion (TTGAAACTATTAATGGGTTA) at this site within the lncRNA:acal transcript.
TTGAAACTATTAATGGGTTA
A fraction of acal1 mutant embryos exhibit dorsal closure defects, with holes in either the dorsal or anterior ends of the embryo. No other cuticular defects are seen.
lncRNA:acal1 is rescued by lncRNA:acal+t178D09
Expression of acal+t178D09 rescues the embryonic lethality seen in acal1 mutants.