Open Close
General Information
D. melanogaster
FlyBase ID
Feature type
Associated gene
Associated Insertion(s)
Carried in Construct
Allele class
Nature of the Allele
Allele class
Mutations Mapped to the Genome
Additional Notes
Associated Sequence Data
DNA sequence
Protein sequence
Progenitor genotype
Carried in construct
Nature of the lesion

A snRNA:U6:96Ac promoter drives expression of two sgRNAs (CCTCATGGACGAAAGCAAGG and ATTGATGAGCGGGAACGCGG), each of which target Snap24 for knockout. The sgRNAs are expressed as a polycistronic cassette based on the tRNA-gRNA design of FBrf0233589.

Allele components
Product class / Tool use(s)
Regulatory region(s)
Encoded product / tool
Expression Data
Reporter Expression
Additional Information
Marker for
Reflects expression of
Reporter construct used in assay
Human Disease Associations
Disease Ontology (DO) Annotations
Models Based on Experimental Evidence ( 0 )
Modifiers Based on Experimental Evidence ( 0 )
Comments on Models/Modifiers Based on Experimental Evidence ( 0 )
Phenotypic Data
Phenotypic Class
Phenotype Manifest In
Detailed Description
External Data
Show genetic interaction network for Enhancers & Suppressors
Phenotypic Class
Phenotype Manifest In
Additional Comments
Genetic Interactions
Xenogenetic Interactions
Complementation and Rescue Data
Images (0)
Stocks (1)
Notes on Origin
External Crossreferences and Linkouts ( 0 )
Synonyms and Secondary IDs (1)
Reported As
Symbol Synonym
Name Synonyms
Secondary FlyBase IDs
    References (1)