A TI{CRIMIC.TG4.1} DNA cassette has been inserted into eIF4B, in a coding intron, and is predicted to gene trap all annotated transcripts of the gene. In addition, the coding exons of eIF4B downstream of the inserted gene trap cassette have been deleted. The TI{CRIMIC.TG4.1} cassette was inserted via the CRISPR/Cas-9 hybrid technique, using two gRNAs that target eIF4B : one targeted to a coding intron (TTCTTGACACGTAATGTAAAAGG) and the other to a non-coding exon in the 3' UTR (ATGTGGGAGAAGCCGTAATTTGG).