Nucleotide changes (AGGTAAGTGT to AGGTCAACAC) in the splice donor sequence of the ratchet point present in the approximately 31kb intron 2 of the longer isoform of Bx.
CAACACCCACCCATTT
Nucleotide changes in the splice donor sequence of the ratchet point present in the approximately 31kb intron 2 of the longer isoform of Bx. AAGTGTCAACACCCACCAATTG is replaced with CAACACCCACCCAtTT.