A TI{KozakGAL4} DNA cassette has been inserted into Ctl2, replacing the coding sequence (coordinates of deleted sequence are 3R:29125414..29127984 , release 6 genome). This results in a simultaneous knock-out of Ctl2 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Ctl2 (predicted to gene trap all annotated transcripts of the gene). The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: CTTTCAGTAGAGAGCGATGACGG and TTGCTCAACCGGCTGCAATTGGG. The PCR check gave the expected-sized band for the right flank and longer than expected band for the left flank. The right insertion site was verified by sequencing.