A TI{KozakGAL4} DNA cassette has been inserted into armi, replacing the coding sequence (coordinates of deleted sequence are 3L:3462318..3466206 , release 6 genome). This results in a simultaneous knock-out of armi plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of armi (the insertion is upstream of the 5' end of the armi-RC transcript and is not expected to trap it, but is expected to trap the other annotated transcripts of the gene). The insertion is also within CG46463 and is not predicted to gene trap this gene. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: AGGAACGGCAGAGCATTTATCGG and TCATCTGTAGTATTCAGTGAAGG.