A TI{KozakGAL4} DNA cassette has been inserted into AstC, replacing the coding sequence (coordinates of deleted sequence are 2L:11076725..11077268 , release 6 genome). This results in a simultaneous knock-out of AstC plus a knock-in of GAL4. The cassette is not predicted to trap AstC or express GAL4 because the insertion was mistakenly targeted to an intron in the 5'UTR rather than an exon in the 5'UTR; however, GAL4 expression was detected in the 3rd-instar larval brain. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: TAACTATTGACTATTAAACAAGG and GGAAGTAAGTTCCCGGACAGTGG.