A TI{KozakGAL4} DNA cassette has been inserted into Apc2, replacing the coding sequence (coordinates of deleted sequence are 3R:24164126..24167642 , release 6 genome). This results in a simultaneous knock-out of Apc2 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Apc2 (predicted to gene trap all annotated transcripts of the gene). The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: ATTCGGATACCAGGGATTCTGGG and GCGTCAGCACTAGAAGCGGATGG. The PCR check of the insertion gave no band for the right flank and the expected sized product for the left flank. The left insertion site was verified by sequencing.