A TI{KozakGAL4} DNA cassette has been inserted into AP-1μ, replacing the coding sequence (coordinates of deleted sequence are 3R:9557830..9559375 , release 6 genome). This results in a simultaneous knock-out of AP-1μ plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of AP-1μ (predicted to gene trap all annotated transcripts of the gene). The upstream end of the deletion associated with the insertion is 385 bp from the annotated TSS of the MBD-like gene on the opposite strand and may affect its expression. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: GGAAGTTGGCAACTGTCGCGAGG and ATCGCAGACAAAAACGCGGGTGG.