A TI{KozakGAL4} DNA cassette has been inserted into Ance-2, replacing the coding sequence (coordinates of deleted sequence are 2L:13909501..13911587 , release 6 genome). This results in a simultaneous knock-out of Ance-2 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of Ance-2 (predicted to gene trap all annotated transcripts of the gene). A small portion of the CDS at the 3' end of the Ance-2 gene is not deleted. The downstream end of the deletion is 496 bp upstream of the annotated TSS of the Acyp gene and may affect its expression. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: ACGACAATCCATGAATCCATGGG and ACTTTCAACCTCTGCAAGACTGG.