A TI{KozakGAL4} DNA cassette has been inserted into CG4806, replacing the coding sequence (coordinates of deleted sequence are 2R:24666225..24668304 , release 6 genome). This results in a simultaneous knock-out of CG4806 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of CG4806 (predicted to gene trap all annotated transcripts of the gene). The downstream end of the deletion associated with the insertion is 203 bp upstream of the annotated TSS of the CG34214 gene and may affect its expression. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: TCAAGAGTTCCACGTGCAAATGG and GCGCTACTCCGTGTACCACTTGG.