A TI{KozakGAL4} DNA cassette has been inserted into CG6938, replacing the coding sequence (coordinates of deleted sequence are 3L:11985955..11990471 , release 6 genome). This results in a simultaneous knock-out of CG6938 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of CG6938 (predicted to gene trap all annotated transcripts of the gene). The downstream end of the deletion associated with the insertion is 265 bp upstream of the annotated TSS of the CG6931 gene and may affect its expression. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: GTCTTCTATCTATGGCGTCATGG and AATAACATGATTACATGAATTGG.