A TI{SA-KozakGAL4} DNA cassette has been inserted into CG7227, replacing the coding sequence (coordinates of deleted sequence are 2L:7994949..7997158 , release 6 genome). This results in a simultaneous knock-out of CG7227 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of CG7227. The deletion also affects asRNA:CR44996. The TI{SA-KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: GTGAATAAACTCATACTTACGGG and ATTGGCTTTAACTGTAGACTAGG.