A TI{KozakGAL4} DNA cassette has been inserted into CG1239, replacing the coding sequence (coordinates of deleted sequence are 3R:5733692..5734646 , release 6 genome). This results in a simultaneous knock-out of CG1239 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of CG1239 (predicted to gene trap all annotated transcripts of the gene). The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: TTATACTTTGGATTTCACAATGG and GACTTTGTAAAAATTTGGATCGG. The 3' end of the deletion associated with the insertion is 52 bp downstream of the 3' end of the CG2100 gene and may affect the proper 3' end formation of its transcripts.