A TI{KozakGAL4} DNA cassette has been inserted into CG3342, replacing the coding sequence (coordinates of deleted sequence are X:6526267..6527806 , release 6 genome). This results in a simultaneous knock-out of CG3342 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of CG3342 (predicted to gene trap all annotated transcripts of the gene). The deletion also removes part of CG3918. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: TGCGACTGCATAATTAGGCATGG and TAAAGATAGCTAATAGTGTCTGG.