A TI{KozakGAL4} DNA cassette has been inserted into CG14893, replacing the coding sequence (coordinates of deleted sequence are 3R:16620810..16622665 , release 6 genome). This results in a simultaneous knock-out of CG14893 plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of CG14893 (predicted to gene trap all annotated transcripts of the gene). The 3' end of the deletion associated with the insertion is 70 bp from the 3' end of Ccdc114 and may affect the proper 3' end formation of its transcripts. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: ACTCGCAATTATCGCATCGGTGG and TTGAATAGACTGTAGTTTATAGG.