A TI{KozakGAL4} DNA cassette has been inserted into ECSIT, replacing the coding sequence (coordinates of deleted sequence are 3R:5856608..5857943 , release 6 genome). The 3' end of the deletion extends 29 bp downstream of the annotated 3' end of the ECSIT gene. This results in a simultaneous knock-out of ECSIT plus a knock-in of GAL4 that is expected to be expressed under the control of the endogenous regulatory sequences of ECSIT (predicted to gene trap all annotated transcripts of the gene). The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: ACAAAACATTGCACAAGCTGCGG and TTTGTATACCATAGAATTGATGG.