A TI{CRIMIC.TG4.0} DNA cassette has been inserted into Cpr, in the coding intron of 3 transcript isoforms, and is predicted to gene trap these isoforms. It is not predicted to trap the Cpr-RB isoform (the insertion is upstream of the 5' transcript start site of this isoform). In the isoforms in which the insertion is in the coding intron, the coding exons downstream of the inserted gene trap cassette have been deleted (in the Cpr-RB isoform, the 5' UTR and all coding sequences are deleted). The TI{CRIMIC.TG4.0} cassette was inserted via the CRISPR/Cas-9 hybrid technique, using two gRNAs that target Cpr : one targeted to a coding intron (TTTGAGCTGCTAGTTTGGCGGGG) and the other to a non-coding exon in the 3' UTR (GAAAACTTTACGCTTATCATCGG).