A TI{CRIMIC.TG4.0} DNA cassette has been inserted into CG3651, in a coding intron, and is predicted to gene trap all annotated transcripts of the gene. In addition, the coding exons of CG3651 downstream of the inserted gene trap cassette have been deleted. The deletion also removes part of the 3' UTR of the CycK-RC transcript (the deletion is downstream of the other two CycK transcript isoforms). The TI{CRIMIC.TG4.0} cassette was inserted via the CRISPR/Cas-9 hybrid technique, using two gRNAs that target CG3651 : one targeted to a coding intron (CTGTTTATCCTTTAAAAAGGTGG) and the other to a non-coding exon in the 3' UTR (TTAATGTGAAAATAAATGAGTGG).