A TI{KozakGAL4} DNA cassette has been inserted into Apc, replacing the coding sequence (coordinates of deleted sequence are 3R:28833237..28841693 , release 6 genome). This results in a simultaneous knock-out of Apc plus a knock-in of GAL4. The cassette is not predicted to trap Apc or express GAL4 because the 5' end of the insertion is in an intron in the 5' UTR. The TI{KozakGAL4} cassette was inserted via the CRISPR/Cas-9 drop-in technique, using a dsDNA donor vector with homology arms of length 200bp. The sgRNA sequences used to target the gene were: GGCTGCCGCCACCTGAATGTTGG and TGGTGGGCGCGCGGAAATAGAGG.