Open Close
General Information
Symbol
Dmel\AA433187
Species
D. melanogaster
Name
AA433187
FlyBase ID
FBcl0000343
Feature type
Computed gene(s)
 
Collection Status
N/A
Known Problems
none
FlyBase assessment
    Library
    ST_cDNA
    • ST cDNA library of D. melanogaster, Canton-S strain, embryo (2-14 hr).
    Strain
      Tissue Source
      Stage
      Tissue/Position (including subcellular localization)
      Reference
      Sequence Data of the Insert
      5' Sequence
      Total bases
      543
      NCBI
      5' sequence dataSequence Downloader
      CACAAACGCCGGGCCACCGGAGGCAAGCGCAAGTCGCTCCGCAAGAAGCGCAAGTTCGAGTTGGGACGCCCCGCCGCCAA
      CACCAAGCTTGGCTCCGGCCGCGTGCACAAGGTGCGCACCCGTGGTGGAAACACCAAGCTCCGTGCTCTGCGCCTGGAAA
      CCGGAAACTTCGCCTGGGCCTCCGAGGGAGTGGCGCGCAAGACCCGTATCGCCGATGTTGTGTACAACGCCTCCAACAAC
      GAGCTGGTGCGAACCAAGACCTTGGTGAAGAACAGTATCGTGGTCATCGATGCCACGCCCTTCCGCCAGTGGTACGAGGC
      TCACTACGTGCTGCCCCTGGGACGCAAGCGTAACCCAAAGCACGCCCAGAAAGAGGACGAGAACGACGTGCTGACCAAGA
      AGCGCAGCGAAAAGGTTATGAAGAAGTACCTGGAGCGCCAGAAGTACGGCAAGGTCGAGCAGGCCCTCGAGGATCAGTTC
      ACCTCCGGCCGCATCTTGGGTTGGATTTCTTCCCGCCCCGGACAGTGCGGGCGCTCCGACGGA
      
      Library Information (1)
      Library: ST_cDNA
      Description

      Cloned cDNAs prepared from polyadenylated RNA isolated from stage 5-16 (2-14-hr) embryos. The strain used was not the iso-1 sequenced strain.

      Sample preparation

      Embryos at 2-14 hr AEL were collected.

      Protocol

      RNA was oligo-dT primed to generate cDNA. Directionally cloned into lambdaZAPII.

      Comment

      GenBank AA433187-AA433290.

      Reported As
      Symbol Synonyms
      ST
      ST_cDNA
      References (1)
      Research paper (1)
      Schmid and Tautz, 1997, Proc. Natl. Acad. Sci. U.S.A. 94(18): 9746--9750
      A screen for fast evolving genes from Drosophila. [FBrf0098343]
      External Crossreferences and Linkouts ( 0 )
      Synonyms and Secondary IDs (0)
      Reported As
      Symbol Synonym
      Secondary FlyBase IDs
        References (0)